Structure of PDB 1gtn Chain P Binding Site BS01

Receptor Information
>1gtn Chain P (length=70) Species: 1422 (Geobacillus stearothermophilus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TNSDFVVIKALEDGVNVIGLTRGADTRFHHSEKLDKGEVLIAQFTEHTSA
IKVRGKAYIQTRHGVIESEG
Ligand information
>1gtn Chain W (length=44) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gagcgagcgagcgagcgagcgagcgagcgagcgagcgagcgagc
............................................
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB1gtn Specificity of Trap-RNA Interactions: Crystal Structures of Two Complexes with Different RNA Sequences
Resolution2.5 Å
Binding residue
(original residue number in PDB)		F32 E36 K37 D39
Binding residue
(residue number reindexed from 1)		F28 E32 K33 D35
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003723 RNA binding
GO:0005515 protein binding
GO:0042802 identical protein binding
Biological Process
GO:0006353 DNA-templated transcription termination
GO:0006355 regulation of DNA-templated transcription

View graph for
Molecular Function
View graph for
Biological Process
External links
PDB RCSB:1gtn, PDBe:1gtn, PDBj:1gtn
PDBsum1gtn
PubMed11914485
UniProtQ9X6J6|MTRB_GEOSE Transcription attenuation protein MtrB (Gene Name=mtrB)

[Back to BioLiP]