Structure of PDB 7abf Chain N Binding Site BS01

Receptor Information
>7abf Chain N (length=56) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
GYYCNVCDCVVKDSINFLDHINGKKHQRNLGMSMRVERSTLDQVKKRFEV
NKKKME
Ligand information
>7abf Chain 6 (length=65) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagggcc
ccugcgcaaggauga
<<<<<.<<....>>>>>>>.............................<.
<<<.....>>>..>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7abf Mechanism of protein-guided folding of the active site U2/U6 RNA during spliceosome activation.
Resolution3.9 Å
Binding residue
(original residue number in PDB)		K90 N94
Binding residue
(residue number reindexed from 1)		K12 N16
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003676 nucleic acid binding
GO:0003677 DNA binding
GO:0005515 protein binding
GO:0008270 zinc ion binding
GO:0046872 metal ion binding
Biological Process
GO:0000398 mRNA splicing, via spliceosome
GO:0006397 mRNA processing
GO:0008380 RNA splicing
Cellular Component
GO:0005634 nucleus
GO:0005654 nucleoplasm
GO:0005681 spliceosomal complex
GO:0046540 U4/U6 x U5 tri-snRNP complex
GO:0071005 U2-type precatalytic spliceosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7abf, PDBe:7abf, PDBj:7abf
PDBsum7abf
PubMed33243851
UniProtQ96NC0|ZMAT2_HUMAN Zinc finger matrin-type protein 2 (Gene Name=ZMAT2)

[Back to BioLiP]