Structure of PDB 5do4 Chain L Binding Site BS01

Receptor Information
>5do4 Chain L (length=32) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
GEADCGLRPLFEKKSLEDKTERELLESYIDGR
Ligand information
>5do4 Chain A (length=25) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gggaacaaagcugaaguacuuaccc
<<<....<<<........>>>.>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5do4 Evoking picomolar binding in RNA by a single phosphorodithioate linkage.
Resolution1.859 Å
Binding residue
(original residue number in PDB)		G35 R36
Binding residue
(residue number reindexed from 1)		G31 R32
Binding affinityPDBbind-CN: Kd=1.8pM
Enzymatic activity
Enzyme Commision number 3.4.21.5: thrombin.
Gene Ontology
Molecular Function
GO:0004252 serine-type endopeptidase activity
Biological Process
GO:0006508 proteolysis
GO:0007596 blood coagulation
Cellular Component
GO:0005576 extracellular region

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:5do4, PDBe:5do4, PDBj:5do4
PDBsum5do4
PubMed27566147
UniProtP00734|THRB_HUMAN Prothrombin (Gene Name=F2)

[Back to BioLiP]