Structure of PDB 6o1o Chain K Binding Site BS01

Receptor Information
>6o1o Chain K (length=118) Species: 274 (Thermus thermophilus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAA
Ligand information
>6o1o Chain N (length=30) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugacguggucguccccgggcgccuuaucua
..............................
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB6o1o Target preference of Type III-A CRISPR-Cas complexes at the transcription bubble.
Resolution3.8 Å
Binding residue
(original residue number in PDB)		X37 X38
Binding residue
(residue number reindexed from 1)		X31 X32
External links