Structure of PDB 1nwq Chain C Binding Site BS01

Receptor Information

>1nwq Chain C (length=60) Species: 10116 (Rattus norvegicus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]

NSNEYRVRRERNNIAVRKSRDKAKQRNVETQQKVLELTSDNDRLRKRVEQ
LSRELDTLRG

Ligand information

>1nwq Chain B (length=21) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]

ttcctattgcgcaatccagtt

Receptor-Ligand Complex Structure

Global view

Local view

Structure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

PDB	1nwq Structural Basis for DNA Recognition by the Basic Region Leucine Zipper Transcription Factor CCAAT/enhancer Binding Protein Alpha
Resolution	2.8 Å
Binding residue (original residue number in PDB)	Y285 R289 N292 N293 R297 R300
Binding residue (residue number reindexed from 1)	Y5 R9 N12 N13 R17 R20

Enzymatic activity

Enzyme Commision number

Gene Ontology

	Molecular Function
GO:0003700	DNA-binding transcription factor activity

	Biological Process
GO:0006351	DNA-templated transcription
GO:0006355	regulation of DNA-templated transcription

View graph for
Molecular Function

View graph for
Biological Process

External links

PDB	RCSB:1nwq, PDBe:1nwq, PDBj:1nwq
PDBsum	1nwq
PubMed	12578822
UniProt	P05554\|CEBPA_RAT CCAAT/enhancer-binding protein alpha (Gene Name=Cebpa)

[Back to BioLiP]