Structure of PDB 1c04 Chain C Binding Site BS01

Receptor Information
>1c04 Chain C (length=67) Species: 2238 (Haloarcula marismortui) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
KTPPAAVLLKKAAGIESGSGEPNRNKVATIKRDKVREIAELKMPDLNAAS
IEAAMRMIEGTARSMGI
Ligand information
>1c04 Chain E (length=58) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccaggauguaggcuuagaagcagccaucauuuaaagaaagcguaauagc
ucacuggu
<<<<<.<<...<<<<.......>>>>...>>........<<<......>>
>..>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB1c04 Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Resolution5.0 Å
Binding residue
(original residue number in PDB)		K6 T7 P9 A11 V12 K15 E21 S22 G23 E26 P27 K47 D50 L51 N52 A53 A54 R61 M62 S69 M70
Binding residue
(residue number reindexed from 1)		K1 T2 P4 A6 V7 K10 E16 S17 G18 E21 P22 K42 D45 L46 N47 A48 A49 R56 M57 S64 M65
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:1c04, PDBe:1c04, PDBj:1c04
PDBsum1c04
PubMed10476961
UniProtP56210|RL11_GEOSE Large ribosomal subunit protein uL11 (Fragment) (Gene Name=rplK)

[Back to BioLiP]