Structure of PDB 4v6m Chain BW Binding Site BS01

Receptor Information

>4v6m Chain BW (length=84) Species: 83333 (Escherichia coli K-12)

AHKKAGGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANV
GCGRDHTLFAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>4v6m Chain AV (length=77)

cggcacguagcgcagccugguagcgcaccgucauggggugucgggggucg
gagguucaaauccucucgugccgacca

<<<<<<<..<<<<.........>>>>.<<<.<<.....>>.>>>.....<
<<<<.......>>>>>>>>>>>>....

Receptor-Ligand Complex Structure

Structure summary

• PDB: 4v6m Cryo-EM structure of the ribosome-SecYE complex in the membrane environment.
• Resolution: 7.1 Å
• Binding residue (original residue number in PDB): H2 K3 K4
• Binding residue (residue number reindexed from 1): H2 K3 K4

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:4v6m, PDBe:4v6m, PDBj:4v6m
• PDBsum: 4v6m
• PubMed: 21499241
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)