Structure of PDB 8ye9 Chain B Binding Site BS01

Receptor Information
>8ye9 Chain B (length=89) Species: 999424 (Streptococcus sp. F0441) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TNAIRNETGTSSKMFNLSKRLYDFKDNNLREIHEALYGLLRAGYDISNMR
DVEELAKYVDVKKSHGKLLDVTRDDIELYHRLFVARFGK
Ligand information
>8ye9 Chain C (length=90) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
uaaagaugagacgcguuuuagagcuaaauagcaaguuaaaauaaggcuag
uccguuaucaacuugaaaaaguggcaccgagucggugcuu
..............<<<<<<..<<<<..>>>>....>>>>>>..<<....
.>>.......<<........>>.<<<<<<...>>>>>>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8ye9 Inhibition mechanisms of CRISPR-Cas9 by AcrIIA25.1 and AcrIIA32.
Resolution3.43 Å
Binding residue
(original residue number in PDB)		E19 T20 N28 R32 G50 L51 A54 K74 R98
Binding residue
(residue number reindexed from 1)		E7 T8 N16 R20 G38 L39 A42 K62 R86
External links