Structure of PDB 8ye6 Chain B Binding Site BS01

Receptor Information
>8ye6 Chain B (length=88) Species: 1301 (Streptococcus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
DGKLVVSKAHFGNMIRNCQSVEDFKKSFERLTYYSSENRESTVRQRLKIA
EKEYNFKAGVKEDLEIKNTTDKEILDYVRNELSKIDSK
Ligand information
>8ye6 Chain C (length=92) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
uaaagaugagacgcguuuuagagcuagaaauagcaaguuaaaauaaggcu
aguccguuaucaacuugaaaaaguggcaccgagucggugcuu
..............<<<<<<..<<<<....>>>>....>>>>>>..<<..
...>>.......<<<<....>>>>.<<<<<<...>>>>>>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8ye6 Inhibition mechanisms of CRISPR-Cas9 by AcrIIA25.1 and AcrIIA32.
Resolution2.95 Å
Binding residue
(original residue number in PDB)		K12 A13 H14 N17 Y37 Q49 K52 K56
Binding residue
(residue number reindexed from 1)		K8 A9 H10 N13 Y33 Q45 K48 K52
External links