Structure of PDB 8com Chain B Binding Site BS01

Receptor Information
>8com Chain B (length=76) Species: 185431 (Trypanosoma brucei brucei TREU927) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
VRGITRGSIRRLARRGGVKRISGVIYDEVRGVLKSFVEGVVRDATAYTEY
SRKKTVTAVDVVNALRKRGKILYGYA
Ligand information
>8com Chain I (length=127) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
tctgacacgtgcctggagactagggagtaatccccttggcggttaaaacg
cgggggacagcgcgtacgtgcgtttaagcggtgctagagctgtctacgac
caattgagcggcctcggcaccgggatt
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8com Histone divergence in trypanosomes results in unique alterations to nucleosome structure.
Resolution3.3 Å
Binding residue
(original residue number in PDB)		T28 G30 R75
Binding residue
(residue number reindexed from 1)		T5 G7 R52
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0030527 structural constituent of chromatin
GO:0046982 protein heterodimerization activity
Biological Process
GO:0006334 nucleosome assembly
Cellular Component
GO:0000786 nucleosome
GO:0005634 nucleus
GO:0005654 nucleoplasm
GO:0005694 chromosome
GO:0005737 cytoplasm
GO:0031981 nuclear lumen
GO:0035869 ciliary transition zone
GO:0097014 ciliary plasm

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:8com, PDBe:8com, PDBj:8com
PDBsum8com
PubMed37427792
UniProtQ57Z31

[Back to BioLiP]