Structure of PDB 1qa6 Chain B Binding Site BS01

Receptor Information
>1qa6 Chain B (length=67) Species: 1422 (Geobacillus stearothermophilus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
KTPPAAVLLKKAAGIESGSGEPNRNKVATIKRDKVREIAELKMPDLNAAS
IEAAMRMIEGTARSMGI
Ligand information
>1qa6 Chain D (length=58) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccaggauguaggcuuagaagcagccaucauuuaaagaaagcguaauagc
ucacuggu
<<<<<.<<...<<<<.......>>>>...>>........<<<......>>
>..>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB1qa6 Crystal structure of a conserved ribosomal protein-RNA complex.
Resolution2.8 Å
Binding residue
(original residue number in PDB)		K6 P9 A10 K15 S22 G23 S24 G25 E26 P27 K47 N52 A54 A58 R61 M62 G65 T66 S69 M70
Binding residue
(residue number reindexed from 1)		K1 P4 A5 K10 S17 G18 S19 G20 E21 P22 K42 N47 A49 A53 R56 M57 G60 T61 S64 M65
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:1qa6, PDBe:1qa6, PDBj:1qa6
PDBsum1qa6
PubMed10325228
UniProtP56210|RL11_GEOSE Large ribosomal subunit protein uL11 (Fragment) (Gene Name=rplK)

[Back to BioLiP]