Structure of PDB 1e8o Chain B Binding Site BS01

Receptor Information
>1e8o Chain B (length=75) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
VLLESEQFLTELTRLFQKCRTSGSVYITLKKYDNKCLLRATDGKKKISTV
VSSKEVNKFQMAYSNLLRANMDGLK
Ligand information
>1e8o Chain E (length=50) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gggccgggcgcgguggcgcgcgccuguagucccagcuacucgggaggcuc
<<<<<<<<<<<<..(((.>>>>>>>....<<<<.)))....>>>>>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB1e8o Structure and Assembly of the Alu Domain of the Mammalian Signal Recognition Particle
Resolution3.2 Å
Binding residue
(original residue number in PDB)		S73 V76 N77 Q80
Binding residue
(residue number reindexed from 1)		S53 V56 N57 Q60
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0008312 7S RNA binding
GO:0030942 endoplasmic reticulum signal peptide binding
Biological Process
GO:0006614 SRP-dependent cotranslational protein targeting to membrane
Cellular Component
GO:0005786 signal recognition particle, endoplasmic reticulum targeting
GO:0048500 signal recognition particle

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:1e8o, PDBe:1e8o, PDBj:1e8o
PDBsum1e8o
PubMed11089964
UniProtP37108|SRP14_HUMAN Signal recognition particle 14 kDa protein (Gene Name=SRP14)

[Back to BioLiP]