Structure of PDB 4r8i Chain A Binding Site BS01

Receptor Information
>4r8i Chain A (length=68) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
DAINAPVTCCYNFTNRKISVQRLASYRRITSSKCPKEAVIFKTIVAKEIC
ADPKQKWVQDSMDHLDKQ
Ligand information
>4r8i Chain B (length=40) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gcacgucccucaccggugcaagugaagccguggcucugcg
<<<....<<....<<<...........>>>.>>...>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB4r8i Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2.
Resolution2.05 Å
Binding residue
(original residue number in PDB)		N17 R18 K19 I20 S21 V22 Q23 R24 K49 W59 H66
Binding residue
(residue number reindexed from 1)		N15 R16 K17 I18 S19 V20 Q21 R22 K47 W57 H64
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0004672 protein kinase activity
GO:0005102 signaling receptor binding
GO:0005125 cytokine activity
GO:0005515 protein binding
GO:0008009 chemokine activity
GO:0031727 CCR2 chemokine receptor binding
GO:0048020 CCR chemokine receptor binding
Biological Process
GO:0001525 angiogenesis
GO:0002548 monocyte chemotaxis
GO:0006468 protein phosphorylation
GO:0006935 chemotaxis
GO:0006954 inflammatory response
GO:0006955 immune response
GO:0006959 humoral immune response
GO:0007010 cytoskeleton organization
GO:0007155 cell adhesion
GO:0007165 signal transduction
GO:0007166 cell surface receptor signaling pathway
GO:0007186 G protein-coupled receptor signaling pathway
GO:0007187 G protein-coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger
GO:0007259 cell surface receptor signaling pathway via JAK-STAT
GO:0008360 regulation of cell shape
GO:0009617 response to bacterium
GO:0009887 animal organ morphogenesis
GO:0019079 viral genome replication
GO:0019221 cytokine-mediated signaling pathway
GO:0019233 sensory perception of pain
GO:0019725 cellular homeostasis
GO:0030335 positive regulation of cell migration
GO:0034351 negative regulation of glial cell apoptotic process
GO:0035684 helper T cell extravasation
GO:0043524 negative regulation of neuron apoptotic process
GO:0043615 astrocyte cell migration
GO:0044344 cellular response to fibroblast growth factor stimulus
GO:0048245 eosinophil chemotaxis
GO:0048246 macrophage chemotaxis
GO:0050870 positive regulation of T cell activation
GO:0051770 positive regulation of nitric-oxide synthase biosynthetic process
GO:0051968 positive regulation of synaptic transmission, glutamatergic
GO:0061844 antimicrobial humoral immune response mediated by antimicrobial peptide
GO:0070098 chemokine-mediated signaling pathway
GO:0071222 cellular response to lipopolysaccharide
GO:0071346 cellular response to type II interferon
GO:0071347 cellular response to interleukin-1
GO:0071356 cellular response to tumor necrosis factor
GO:0090280 positive regulation of calcium ion import
GO:1904783 positive regulation of NMDA glutamate receptor activity
GO:1905563 negative regulation of vascular endothelial cell proliferation
GO:2000134 negative regulation of G1/S transition of mitotic cell cycle
GO:2000353 positive regulation of endothelial cell apoptotic process
GO:2000427 positive regulation of apoptotic cell clearance
GO:2000502 negative regulation of natural killer cell chemotaxis
Cellular Component
GO:0005576 extracellular region
GO:0005615 extracellular space

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:4r8i, PDBe:4r8i, PDBj:4r8i
PDBsum4r8i
PubMed25901662
UniProtP13500|CCL2_HUMAN C-C motif chemokine 2 (Gene Name=CCL2)

[Back to BioLiP]