Structure of PDB 1dh3 Chain A Binding Site BS01

Receptor Information

>1dh3 Chain A (length=55) Species: 10090 (Mus musculus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]

KREVRLMKNREAARESRRKKKEYVKSLENRVAVLENQNKTLIEELKALKD
LYSHK

Ligand information

>1dh3 Chain B (length=21) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]

ccttggctgacgtcagccaag

Receptor-Ligand Complex Structure

Global view

Local view

Structure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

PDB	1dh3 The structure of a CREB bZIP.somatostatin CRE complex reveals the basis for selective dimerization and divalent cation-enhanced DNA binding
Resolution	3.0 Å
Binding residue (original residue number in PDB)	N293 R294 R298 R301
Binding residue (residue number reindexed from 1)	N9 R10 R14 R17
Binding affinity	PDBbind-CN: Kd=1.4nM

Enzymatic activity

Enzyme Commision number

Gene Ontology

	Molecular Function
GO:0003677	DNA binding
GO:0003700	DNA-binding transcription factor activity

	Biological Process
GO:0006355	regulation of DNA-templated transcription

	Cellular Component
GO:0005634	nucleus

View graph for
Molecular Function

View graph for
Biological Process

View graph for
Cellular Component

External links

PDB	RCSB:1dh3, PDBe:1dh3, PDBj:1dh3
PDBsum	1dh3
PubMed	10952992
UniProt	Q01147\|CREB1_MOUSE Cyclic AMP-responsive element-binding protein 1 (Gene Name=Creb1)

[Back to BioLiP]