Structure of PDB 7of2 Chain 8 Binding Site BS01

Receptor Information
>7of2 Chain 8 (length=77) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
ELTFEETERRALLLKKWSLYKQQERKMERDTIRAMLEAQQEALEELQLES
PKLHAEAIKRDPNLFPFEKEGPHYTPP
Ligand information
>7of2 Chain B (length=56) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7of2 Structural basis of GTPase-mediated mitochondrial ribosome biogenesis and recycling.
Resolution2.7 Å
Binding residue
(original residue number in PDB)		K119 W121 L123 K125 Q126 R129
Binding residue
(residue number reindexed from 1)		K15 W17 L19 K21 Q22 R25
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003723 RNA binding
GO:0005515 protein binding
Biological Process
GO:0009653 anatomical structure morphogenesis
GO:0032543 mitochondrial translation
Cellular Component
GO:0005634 nucleus
GO:0005730 nucleolus
GO:0005739 mitochondrion
GO:0005743 mitochondrial inner membrane
GO:0005761 mitochondrial ribosome
GO:0005762 mitochondrial large ribosomal subunit
GO:0005840 ribosome
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7of2, PDBe:7of2, PDBj:7of2
PDBsum7of2
PubMed34135319
UniProtQ9NQ50|RM40_HUMAN Large ribosomal subunit protein mL40 (Gene Name=MRPL40)

[Back to BioLiP]