Structure of PDB 5zet Chain 1 Binding Site BS01

Receptor Information
>5zet Chain 1 (length=60) Species: 246196 (Mycolicibacterium smegmatis MC2 155) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AELKITQVRSTIGARWKQRESLRTLGLKKIRQSVVREDNAQTRGLINTVH
HLVEVEEVGK
Ligand information
>5zet Chain B (length=117) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
guuacggcgguccauagcggcagggaaacgcccggucccaucccgaaccc
ggaagcuaagccugccagcgccgaugauacuacccuuccggguggaaaag
uaggacaccgccgaaca
<<<..<..<..........<........<.<...................
>...>.......>.................<.<......>.>........
.......>..>..>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5zet Structures of Mycobacterium smegmatis 70S ribosomes in complex with HPF, tmRNA, and P-tRNA.
Resolution3.2 Å
Binding residue
(original residue number in PDB)		R16 H52
Binding residue
(residue number reindexed from 1)		R15 H51
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome
GO:0015934 large ribosomal subunit
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:5zet, PDBe:5zet, PDBj:5zet
PDBsum5zet
PubMed30206241
UniProtA0QSG7|RL30_MYCS2 Large ribosomal subunit protein uL30 (Gene Name=rpmD)

[Back to BioLiP]